Review





Similar Products

95
ATCC nox duox enzymes22
Nox Duox Enzymes22, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nox/pm41966329-149-5-10?v=ATCC
Average 95 stars, based on 1 article reviews
nox duox enzymes22 - by Bioz Stars, 2026-07
95/100 stars
  Buy from Supplier

86
Noxxon Pharma olaptesed pegol nox a12 cll
Olaptesed Pegol Nox A12 Cll, supplied by Noxxon Pharma, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nox/pmc13149467-19-0-6?v=Noxxon+Pharma
Average 86 stars, based on 1 article reviews
olaptesed pegol nox a12 cll - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier

86
Noxxon Pharma olaptesed pegol nox a12 multiple myeloma
Olaptesed Pegol Nox A12 Multiple Myeloma, supplied by Noxxon Pharma, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nox/pmc13149467-20-0-7?v=Noxxon+Pharma
Average 86 stars, based on 1 article reviews
olaptesed pegol nox a12 multiple myeloma - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier

86
Eicom Corporation nox analyzer eno 20
Nox Analyzer Eno 20, supplied by Eicom Corporation, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nox/pmc13066071-120-16-19?v=Eicom+Corporation
Average 86 stars, based on 1 article reviews
nox analyzer eno 20 - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier

86
Brinkmann Instruments nadph oxidase nox dependent nets formation
<t>NETs</t> formation overview. The first way is through <t>NOX-dependent</t> NETs formation. When neutrophils are stimulated by factors such as phorbol myristate acetate (PMA), <t>NADPH</t> oxidase is activated through the RAF/MEK/ERK and the protein kinase C (PKC) signaling pathway, leading to the synthesis of reactive oxygen species (ROS). Subsequently, neutrophil elastase (NE) and myeloperoxidase (MPO) stored in cytoplasmic granules translocate into the nuclear. MPO and NE synergize to promote chromatin decondensation. Peptidyl-arginine deiminase-4 (PAD4) boosts the chromatin decondensation of nuclear DNA by catalyzing the conversion of arginine to citrullines in histones. Decondensed chromatin mixed with granule proteins is first released into the cytoplasm and then out of the cell membrane, and forms NETs. LPS can activate JNK signaling and promote the formation of NOX-dependent NETs. The second way is through NOX-independent NETs formation. The formation of such NETs is related to calcium influx and the generation of mitochondrial ROS (mROS). When neutrophils are stimulated by calcium ionophores such as ionomycin and A23128, Calcium ions activate small conductance calcium activated potassium 3 channel (SK3), SK3 mediates the production of mROS. Stimulated by calcium influx and mROS, PAD4 translocate from the cytosol to the nuclear. PAD4-mediated citrullination further promotes decondensation of nuclear DNA, thereby facilitating NET formation
Nadph Oxidase Nox Dependent Nets Formation, supplied by Brinkmann Instruments, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nox/pmc13038820-32-19-25?v=Brinkmann+Instruments
Average 86 stars, based on 1 article reviews
nadph oxidase nox dependent nets formation - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier

93
Addgene inc mito lb nox cdna
(A) Schematic of [U- 13 C]glucose labeling. m+2-labeled citrate generated from pyruvate oxidation is further oxidized to m+2-labeled malate in the canonical TCA cycle. (B) Fractional m+2 enrichment of malate relative to m+2 citrate (mal+2/cit+2) from 82 NSCLC lines cultured with [U- C]glucose for 6 h, obtained from a published dataset. (C) Bubble plot of gene set enrichment analysis depicting gene sets enriched among genes positively correlating with the mal+2/cit+2 ratio in 69 NSCLC lines. (D) Simple linear regression comparing mitochondrial oxygen consumption rates (average of 6–8 replicates/cell line) and mal+2/cit+2 from [U- 13 C]glucose (average of 3 replicates/cell line). Correlation was determined using Pearson ( r ). (E) Mal+2/cit+2 from [U- 13 C]glucose in A549 cells treated with indicated concentrations of phenformin for 24 h. b.l.q, fractional enrichment below the limit of quantification. (F and G) Mal+2/cit+2 from [U- 13 C]glucose in NSCLC lines treated with vehicle or 1 μM FCCP for 24 h (F) or expressing either empty vector or <t>mito</t> Lb <t>NOX</t> (G). Data are mean ± SD with n = 3 independent replicates (E–G). Significance was assessed using two-way ANOVA with Sidak’s multiple-comparisons post-test relative to vehicle (F) or empty vector-expressing cells (G). See also and .
Mito Lb Nox Cdna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nox/pmc13045649-418-152-156?v=Addgene+inc
Average 93 stars, based on 1 article reviews
mito lb nox cdna - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

95
Novus Biologicals nox 4
(A) Schematic of [U- 13 C]glucose labeling. m+2-labeled citrate generated from pyruvate oxidation is further oxidized to m+2-labeled malate in the canonical TCA cycle. (B) Fractional m+2 enrichment of malate relative to m+2 citrate (mal+2/cit+2) from 82 NSCLC lines cultured with [U- C]glucose for 6 h, obtained from a published dataset. (C) Bubble plot of gene set enrichment analysis depicting gene sets enriched among genes positively correlating with the mal+2/cit+2 ratio in 69 NSCLC lines. (D) Simple linear regression comparing mitochondrial oxygen consumption rates (average of 6–8 replicates/cell line) and mal+2/cit+2 from [U- 13 C]glucose (average of 3 replicates/cell line). Correlation was determined using Pearson ( r ). (E) Mal+2/cit+2 from [U- 13 C]glucose in A549 cells treated with indicated concentrations of phenformin for 24 h. b.l.q, fractional enrichment below the limit of quantification. (F and G) Mal+2/cit+2 from [U- 13 C]glucose in NSCLC lines treated with vehicle or 1 μM FCCP for 24 h (F) or expressing either empty vector or <t>mito</t> Lb <t>NOX</t> (G). Data are mean ± SD with n = 3 independent replicates (E–G). Significance was assessed using two-way ANOVA with Sidak’s multiple-comparisons post-test relative to vehicle (F) or empty vector-expressing cells (G). See also and .
Nox 4, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nox/pm41751371-94-52-55?v=Novus+Biologicals
Average 95 stars, based on 1 article reviews
nox 4 - by Bioz Stars, 2026-07
95/100 stars
  Buy from Supplier

96
Proteintech nox et1607 4
(A) Schematic of [U- 13 C]glucose labeling. m+2-labeled citrate generated from pyruvate oxidation is further oxidized to m+2-labeled malate in the canonical TCA cycle. (B) Fractional m+2 enrichment of malate relative to m+2 citrate (mal+2/cit+2) from 82 NSCLC lines cultured with [U- C]glucose for 6 h, obtained from a published dataset. (C) Bubble plot of gene set enrichment analysis depicting gene sets enriched among genes positively correlating with the mal+2/cit+2 ratio in 69 NSCLC lines. (D) Simple linear regression comparing mitochondrial oxygen consumption rates (average of 6–8 replicates/cell line) and mal+2/cit+2 from [U- 13 C]glucose (average of 3 replicates/cell line). Correlation was determined using Pearson ( r ). (E) Mal+2/cit+2 from [U- 13 C]glucose in A549 cells treated with indicated concentrations of phenformin for 24 h. b.l.q, fractional enrichment below the limit of quantification. (F and G) Mal+2/cit+2 from [U- 13 C]glucose in NSCLC lines treated with vehicle or 1 μM FCCP for 24 h (F) or expressing either empty vector or <t>mito</t> Lb <t>NOX</t> (G). Data are mean ± SD with n = 3 independent replicates (E–G). Significance was assessed using two-way ANOVA with Sidak’s multiple-comparisons post-test relative to vehicle (F) or empty vector-expressing cells (G). See also and .
Nox Et1607 4, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nox/pm41740638-143-14-20?v=Proteintech
Average 96 stars, based on 1 article reviews
nox et1607 4 - by Bioz Stars, 2026-07
96/100 stars
  Buy from Supplier

93
Addgene inc puc57 mito lb nox plasmid
(A) Schematic of [U- 13 C]glucose labeling. m+2-labeled citrate generated from pyruvate oxidation is further oxidized to m+2-labeled malate in the canonical TCA cycle. (B) Fractional m+2 enrichment of malate relative to m+2 citrate (mal+2/cit+2) from 82 NSCLC lines cultured with [U- C]glucose for 6 h, obtained from a published dataset. (C) Bubble plot of gene set enrichment analysis depicting gene sets enriched among genes positively correlating with the mal+2/cit+2 ratio in 69 NSCLC lines. (D) Simple linear regression comparing mitochondrial oxygen consumption rates (average of 6–8 replicates/cell line) and mal+2/cit+2 from [U- 13 C]glucose (average of 3 replicates/cell line). Correlation was determined using Pearson ( r ). (E) Mal+2/cit+2 from [U- 13 C]glucose in A549 cells treated with indicated concentrations of phenformin for 24 h. b.l.q, fractional enrichment below the limit of quantification. (F and G) Mal+2/cit+2 from [U- 13 C]glucose in NSCLC lines treated with vehicle or 1 μM FCCP for 24 h (F) or expressing either empty vector or <t>mito</t> Lb <t>NOX</t> (G). Data are mean ± SD with n = 3 independent replicates (E–G). Significance was assessed using two-way ANOVA with Sidak’s multiple-comparisons post-test relative to vehicle (F) or empty vector-expressing cells (G). See also and .
Puc57 Mito Lb Nox Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nox/pmc12915623-408-25-29?v=Addgene+inc
Average 93 stars, based on 1 article reviews
puc57 mito lb nox plasmid - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

Image Search Results


NETs formation overview. The first way is through NOX-dependent NETs formation. When neutrophils are stimulated by factors such as phorbol myristate acetate (PMA), NADPH oxidase is activated through the RAF/MEK/ERK and the protein kinase C (PKC) signaling pathway, leading to the synthesis of reactive oxygen species (ROS). Subsequently, neutrophil elastase (NE) and myeloperoxidase (MPO) stored in cytoplasmic granules translocate into the nuclear. MPO and NE synergize to promote chromatin decondensation. Peptidyl-arginine deiminase-4 (PAD4) boosts the chromatin decondensation of nuclear DNA by catalyzing the conversion of arginine to citrullines in histones. Decondensed chromatin mixed with granule proteins is first released into the cytoplasm and then out of the cell membrane, and forms NETs. LPS can activate JNK signaling and promote the formation of NOX-dependent NETs. The second way is through NOX-independent NETs formation. The formation of such NETs is related to calcium influx and the generation of mitochondrial ROS (mROS). When neutrophils are stimulated by calcium ionophores such as ionomycin and A23128, Calcium ions activate small conductance calcium activated potassium 3 channel (SK3), SK3 mediates the production of mROS. Stimulated by calcium influx and mROS, PAD4 translocate from the cytosol to the nuclear. PAD4-mediated citrullination further promotes decondensation of nuclear DNA, thereby facilitating NET formation

Journal: Cellular and Molecular Neurobiology

Article Title: The Interaction of Neutrophil Extracellular Traps and Complement in Intracerebral Hemorrhage

doi: 10.1007/s10571-026-01675-0

Figure Lengend Snippet: NETs formation overview. The first way is through NOX-dependent NETs formation. When neutrophils are stimulated by factors such as phorbol myristate acetate (PMA), NADPH oxidase is activated through the RAF/MEK/ERK and the protein kinase C (PKC) signaling pathway, leading to the synthesis of reactive oxygen species (ROS). Subsequently, neutrophil elastase (NE) and myeloperoxidase (MPO) stored in cytoplasmic granules translocate into the nuclear. MPO and NE synergize to promote chromatin decondensation. Peptidyl-arginine deiminase-4 (PAD4) boosts the chromatin decondensation of nuclear DNA by catalyzing the conversion of arginine to citrullines in histones. Decondensed chromatin mixed with granule proteins is first released into the cytoplasm and then out of the cell membrane, and forms NETs. LPS can activate JNK signaling and promote the formation of NOX-dependent NETs. The second way is through NOX-independent NETs formation. The formation of such NETs is related to calcium influx and the generation of mitochondrial ROS (mROS). When neutrophils are stimulated by calcium ionophores such as ionomycin and A23128, Calcium ions activate small conductance calcium activated potassium 3 channel (SK3), SK3 mediates the production of mROS. Stimulated by calcium influx and mROS, PAD4 translocate from the cytosol to the nuclear. PAD4-mediated citrullination further promotes decondensation of nuclear DNA, thereby facilitating NET formation

Article Snippet: Depending on whether or not it depends on NADPH oxidase, we divide the NETs formation mechanism into two types: NADPH oxidase (NOX) dependent NETs formation (Brinkmann et al. ; Khan et al. ) and NETs formation independent of NOX (Pilsczek et al. ).

Techniques: Membrane

(A) Schematic of [U- 13 C]glucose labeling. m+2-labeled citrate generated from pyruvate oxidation is further oxidized to m+2-labeled malate in the canonical TCA cycle. (B) Fractional m+2 enrichment of malate relative to m+2 citrate (mal+2/cit+2) from 82 NSCLC lines cultured with [U- C]glucose for 6 h, obtained from a published dataset. (C) Bubble plot of gene set enrichment analysis depicting gene sets enriched among genes positively correlating with the mal+2/cit+2 ratio in 69 NSCLC lines. (D) Simple linear regression comparing mitochondrial oxygen consumption rates (average of 6–8 replicates/cell line) and mal+2/cit+2 from [U- 13 C]glucose (average of 3 replicates/cell line). Correlation was determined using Pearson ( r ). (E) Mal+2/cit+2 from [U- 13 C]glucose in A549 cells treated with indicated concentrations of phenformin for 24 h. b.l.q, fractional enrichment below the limit of quantification. (F and G) Mal+2/cit+2 from [U- 13 C]glucose in NSCLC lines treated with vehicle or 1 μM FCCP for 24 h (F) or expressing either empty vector or mito Lb NOX (G). Data are mean ± SD with n = 3 independent replicates (E–G). Significance was assessed using two-way ANOVA with Sidak’s multiple-comparisons post-test relative to vehicle (F) or empty vector-expressing cells (G). See also and .

Journal: Cell

Article Title: Citrate clearance is a major function of aconitase 2 in the canonical TCA cycle

doi: 10.1016/j.cell.2026.01.028

Figure Lengend Snippet: (A) Schematic of [U- 13 C]glucose labeling. m+2-labeled citrate generated from pyruvate oxidation is further oxidized to m+2-labeled malate in the canonical TCA cycle. (B) Fractional m+2 enrichment of malate relative to m+2 citrate (mal+2/cit+2) from 82 NSCLC lines cultured with [U- C]glucose for 6 h, obtained from a published dataset. (C) Bubble plot of gene set enrichment analysis depicting gene sets enriched among genes positively correlating with the mal+2/cit+2 ratio in 69 NSCLC lines. (D) Simple linear regression comparing mitochondrial oxygen consumption rates (average of 6–8 replicates/cell line) and mal+2/cit+2 from [U- 13 C]glucose (average of 3 replicates/cell line). Correlation was determined using Pearson ( r ). (E) Mal+2/cit+2 from [U- 13 C]glucose in A549 cells treated with indicated concentrations of phenformin for 24 h. b.l.q, fractional enrichment below the limit of quantification. (F and G) Mal+2/cit+2 from [U- 13 C]glucose in NSCLC lines treated with vehicle or 1 μM FCCP for 24 h (F) or expressing either empty vector or mito Lb NOX (G). Data are mean ± SD with n = 3 independent replicates (E–G). Significance was assessed using two-way ANOVA with Sidak’s multiple-comparisons post-test relative to vehicle (F) or empty vector-expressing cells (G). See also and .

Article Snippet: The following sgRNA sequences were used: Chr8: 5’ GACATTTCTTTCCCCACTGG 3’ AAVS1: 5’ GGGGCCACTAGGGACAGGAT 3’ ACO2 ( homo sapiens ) guide 1: 5’ AGCGAGGCAAGTCGTACCTG 3’ ACO2 ( homo sapiens ) guide 2: 5’ CCAGCCAGGAAATTGAGCG 3’ PDK1 ( homo sapiens ) guide 1: 5’ GAACTGCTTCATGGAGAGCG 3’ PDK1 ( homo sapiens ) guide 2: 5’ TTGCCGCAGAAACATAAATG 3’ CS ( homo sapiens ) guide 1: 5’ CAACATGGCAAGACGGTGGT 3’ CS ( homo sapiens ) guide 2: 5’ AACTGGACATATCCCAACAG 3’ ACL ( homo sapiens ) guide 1: 5’ ACCAGCTGATCAAACGTCG 3’ ACL ( homo sapiens ) guide 2: 5’ AGAATCGGTTCAAGTATGCT 3’ ACO1 ( homo sapiens ) guide 1: 5’ CCATTGGATCCTGTACAACC 3’ ACO1 ( homo sapiens ) guide 2: 5’ TCCTGCAGGATGACACGAGC 3’ SLC25A1 ( homo sapiens ): 5’ CGTCTTCACGTACTCGGTG 3’ ACO2 ( mus musculus ) guide 1: 5’ GCCAACCAGGAGATCGAGCG 3’ ACO2 ( mus musculus ) guide 2: 5’ ACTGATTCGCACACCCCCAA 3’ To stably introduce expression of mitochondrially-targeted Lactobacillus brevis NADH oxidase, mito Lb NOX cDNA (Addgene, 74448) was cloned into pCDH-CMV-MCS-EF1α-puro (System Biosciences, CD510B-1).

Techniques: Labeling, Generated, Cell Culture, Expressing, Plasmid Preparation

(A) Schematic depicting pyruvate dehydrogenase (PDH) regulation by NAD + /NADH and PDH kinase 1 (PDK1). DCA, dichloroacetate; MPCi, mitochondrial pyruvate carrier inhibition. (B) Immunoblot of empty vector- and mito Lb NOX-expressing cells treated with vehicle or 2.5 μM phenformin for 24 h. (C) Fractional m+2 enrichment of citrate from [U- 13 C]glucose in empty vector- and mito Lb NOX-expressing Calu1 cells treated with vehicle or 2.5 μM phenformin for 24 h. (D and E) Fractional m+2 enrichment of citrate (D) and mal+2/cit+2 (E) from [U- 13 C]glucose in Calu1 cells expressing either control sgRNA (sgAAVS1) or sgRNA targeting PDK1 treated with vehicle or 2.5 μM phenformin for 24 h. b.l.q, fractional enrichment below the limit of quantification. (F) Citrate pools plotted against mal+2/cit+2 from [U- 13 C]glucose in 16 NSCLC lines, each averaged across three replicates. Correlation was determined using Pearson ( r ). (G) Metabolites ranked by Pearson correlation ( r ) comparing levels of 225 metabolites (DepMap) and mal+2/cit+2 from [U- C]glucose in 60 NSCLC lines from a published dataset. (H) Simple linear regression comparing the fold change in citrate levels and the change in mal+2/cit+2 from [U- 13 C]glucose with mito Lb NOX expression compared with empty vector (average of 3 replicates per line). Correlation was determined using Pearson ( r ). (I) Log 2 (fold change) of indicated metabolites in Calu1 PDK1 -edited cells relative to the average of control cells (sgAAVS1), shown in triplicate. (J) Mal+2/cit+2 from [U- 13 C]glucose in A549 and Calu1 cells. Data are mean ± SD with n = 3 (C, I, and J), n = 6 (D), or n = 5–6 (E) independent replicates. Significance was assessed using two-way ANOVA with Sidak’s multiple-comparisons post-test relative to vehicle (C and J) or to sgAAVS1 control cells (D and E). See also .

Journal: Cell

Article Title: Citrate clearance is a major function of aconitase 2 in the canonical TCA cycle

doi: 10.1016/j.cell.2026.01.028

Figure Lengend Snippet: (A) Schematic depicting pyruvate dehydrogenase (PDH) regulation by NAD + /NADH and PDH kinase 1 (PDK1). DCA, dichloroacetate; MPCi, mitochondrial pyruvate carrier inhibition. (B) Immunoblot of empty vector- and mito Lb NOX-expressing cells treated with vehicle or 2.5 μM phenformin for 24 h. (C) Fractional m+2 enrichment of citrate from [U- 13 C]glucose in empty vector- and mito Lb NOX-expressing Calu1 cells treated with vehicle or 2.5 μM phenformin for 24 h. (D and E) Fractional m+2 enrichment of citrate (D) and mal+2/cit+2 (E) from [U- 13 C]glucose in Calu1 cells expressing either control sgRNA (sgAAVS1) or sgRNA targeting PDK1 treated with vehicle or 2.5 μM phenformin for 24 h. b.l.q, fractional enrichment below the limit of quantification. (F) Citrate pools plotted against mal+2/cit+2 from [U- 13 C]glucose in 16 NSCLC lines, each averaged across three replicates. Correlation was determined using Pearson ( r ). (G) Metabolites ranked by Pearson correlation ( r ) comparing levels of 225 metabolites (DepMap) and mal+2/cit+2 from [U- C]glucose in 60 NSCLC lines from a published dataset. (H) Simple linear regression comparing the fold change in citrate levels and the change in mal+2/cit+2 from [U- 13 C]glucose with mito Lb NOX expression compared with empty vector (average of 3 replicates per line). Correlation was determined using Pearson ( r ). (I) Log 2 (fold change) of indicated metabolites in Calu1 PDK1 -edited cells relative to the average of control cells (sgAAVS1), shown in triplicate. (J) Mal+2/cit+2 from [U- 13 C]glucose in A549 and Calu1 cells. Data are mean ± SD with n = 3 (C, I, and J), n = 6 (D), or n = 5–6 (E) independent replicates. Significance was assessed using two-way ANOVA with Sidak’s multiple-comparisons post-test relative to vehicle (C and J) or to sgAAVS1 control cells (D and E). See also .

Article Snippet: The following sgRNA sequences were used: Chr8: 5’ GACATTTCTTTCCCCACTGG 3’ AAVS1: 5’ GGGGCCACTAGGGACAGGAT 3’ ACO2 ( homo sapiens ) guide 1: 5’ AGCGAGGCAAGTCGTACCTG 3’ ACO2 ( homo sapiens ) guide 2: 5’ CCAGCCAGGAAATTGAGCG 3’ PDK1 ( homo sapiens ) guide 1: 5’ GAACTGCTTCATGGAGAGCG 3’ PDK1 ( homo sapiens ) guide 2: 5’ TTGCCGCAGAAACATAAATG 3’ CS ( homo sapiens ) guide 1: 5’ CAACATGGCAAGACGGTGGT 3’ CS ( homo sapiens ) guide 2: 5’ AACTGGACATATCCCAACAG 3’ ACL ( homo sapiens ) guide 1: 5’ ACCAGCTGATCAAACGTCG 3’ ACL ( homo sapiens ) guide 2: 5’ AGAATCGGTTCAAGTATGCT 3’ ACO1 ( homo sapiens ) guide 1: 5’ CCATTGGATCCTGTACAACC 3’ ACO1 ( homo sapiens ) guide 2: 5’ TCCTGCAGGATGACACGAGC 3’ SLC25A1 ( homo sapiens ): 5’ CGTCTTCACGTACTCGGTG 3’ ACO2 ( mus musculus ) guide 1: 5’ GCCAACCAGGAGATCGAGCG 3’ ACO2 ( mus musculus ) guide 2: 5’ ACTGATTCGCACACCCCCAA 3’ To stably introduce expression of mitochondrially-targeted Lactobacillus brevis NADH oxidase, mito Lb NOX cDNA (Addgene, 74448) was cloned into pCDH-CMV-MCS-EF1α-puro (System Biosciences, CD510B-1).

Techniques: Inhibition, Western Blot, Plasmid Preparation, Expressing, Control

(A and B) Citrate levels (A) and population doublings (B) in cells expressing indicated sgRNA. (C and D) Population doublings (C) and citrate levels (D) of control (sgAAVS1, –) or ACO2 -edited cells (+) that additionally express either control sgRNA (sgAAVS1) or sgRNA targeting CS , treated as indicated for 72 h (C) or 24 h (D). (E and F) Schematic depicting competition experiment (left). A549 cells with sgAAVS1 expressing mCherry were mixed 1:1 with cells expressing BFP and edited with control (sgAAVS1), sgACO2, sgCS, or both sgACO2 and sgCS and assessed over time (E) or assessed after 21 days in culture with vehicle or indicated concentrations of pyruvate (F). (G) Population doublings of ACO2 -edited cells expressing empty vector (–) or SLC25A1 cDNA (+). Data n = 1 (E) or are mean ± SD with n = 3 (A–D, F, and G) independent replicates. Significance was assessed using two-way ANOVA with Sidak’s multiple-comparisons post-test relative to sgAAVS1 control cells (A), relative to vehicle (C, D, and F) or relative to sgACO2/empty vector cells (G). See also and .

Journal: Cell

Article Title: Citrate clearance is a major function of aconitase 2 in the canonical TCA cycle

doi: 10.1016/j.cell.2026.01.028

Figure Lengend Snippet: (A and B) Citrate levels (A) and population doublings (B) in cells expressing indicated sgRNA. (C and D) Population doublings (C) and citrate levels (D) of control (sgAAVS1, –) or ACO2 -edited cells (+) that additionally express either control sgRNA (sgAAVS1) or sgRNA targeting CS , treated as indicated for 72 h (C) or 24 h (D). (E and F) Schematic depicting competition experiment (left). A549 cells with sgAAVS1 expressing mCherry were mixed 1:1 with cells expressing BFP and edited with control (sgAAVS1), sgACO2, sgCS, or both sgACO2 and sgCS and assessed over time (E) or assessed after 21 days in culture with vehicle or indicated concentrations of pyruvate (F). (G) Population doublings of ACO2 -edited cells expressing empty vector (–) or SLC25A1 cDNA (+). Data n = 1 (E) or are mean ± SD with n = 3 (A–D, F, and G) independent replicates. Significance was assessed using two-way ANOVA with Sidak’s multiple-comparisons post-test relative to sgAAVS1 control cells (A), relative to vehicle (C, D, and F) or relative to sgACO2/empty vector cells (G). See also and .

Article Snippet: The following sgRNA sequences were used: Chr8: 5’ GACATTTCTTTCCCCACTGG 3’ AAVS1: 5’ GGGGCCACTAGGGACAGGAT 3’ ACO2 ( homo sapiens ) guide 1: 5’ AGCGAGGCAAGTCGTACCTG 3’ ACO2 ( homo sapiens ) guide 2: 5’ CCAGCCAGGAAATTGAGCG 3’ PDK1 ( homo sapiens ) guide 1: 5’ GAACTGCTTCATGGAGAGCG 3’ PDK1 ( homo sapiens ) guide 2: 5’ TTGCCGCAGAAACATAAATG 3’ CS ( homo sapiens ) guide 1: 5’ CAACATGGCAAGACGGTGGT 3’ CS ( homo sapiens ) guide 2: 5’ AACTGGACATATCCCAACAG 3’ ACL ( homo sapiens ) guide 1: 5’ ACCAGCTGATCAAACGTCG 3’ ACL ( homo sapiens ) guide 2: 5’ AGAATCGGTTCAAGTATGCT 3’ ACO1 ( homo sapiens ) guide 1: 5’ CCATTGGATCCTGTACAACC 3’ ACO1 ( homo sapiens ) guide 2: 5’ TCCTGCAGGATGACACGAGC 3’ SLC25A1 ( homo sapiens ): 5’ CGTCTTCACGTACTCGGTG 3’ ACO2 ( mus musculus ) guide 1: 5’ GCCAACCAGGAGATCGAGCG 3’ ACO2 ( mus musculus ) guide 2: 5’ ACTGATTCGCACACCCCCAA 3’ To stably introduce expression of mitochondrially-targeted Lactobacillus brevis NADH oxidase, mito Lb NOX cDNA (Addgene, 74448) was cloned into pCDH-CMV-MCS-EF1α-puro (System Biosciences, CD510B-1).

Techniques: Expressing, Control, Plasmid Preparation

(A) Serum citrate concentration in mice provided drinking water supplemented with NaCl (control) or 3% citrate 10 days post tamoxifen administration (control water: n = 12 Aco2 +/+ , 11 Aco2 fl/fl ; citrate water: n = 14 Aco2 +/+ , 10 Aco2 fl/fl ). (B) Survival curves of indicated mice post tamoxifen (TAM) administration (control water: n = 4 Aco2 +/+ , 9 Aco2 fl/fl ; citrate water: n = 9 Aco2 +/+ , 12 Aco2 fl/fl ). (C) Violin plot depicting Z scores of 122 ISR-related genes in kidneys harvested from mice provided regular water or water supplemented with 3% citrate 10 days post tamoxifen administration ( n = 6 for all conditions except n = 7 for Aco2 fl/fl mice on 3% citrate). (D) Normalized enrichment scores of gene sets related to kidney injury or proximal tubule (PT) identity from RNA sequencing of kidneys described in (C), comparing Aco2 fl/fl vs. Aco2 +/+ animals on regular water (left column) or 3% citrate (right column). Selected gene sets represent genes increased or decreased following acute kidney injury (AKI), associated with AKI in PT cells specifically, or clusters associated with normal PT identity (segments 1–3) or injury. (E) SLC13A2 and SLC13A5 expression in cancer cell lines of kidney ( n = 51) or liver ( n = 27) lineage (TPM, transcripts per million). (F) Citrate levels in HepG2 cells cultured as indicated for 24 h. (G and H) Percent DAPI-positivity (G) or population doublings (H) in HepG2 cells cultured as indicated for 3 days. (I) Percent DAPI-positive cells of indicated genotype cultured in 5 mM (A549) or 1 mM (Calu1) citrate for 3 days. (J) Cellular competition experiment mixing ACO2 -edited cells expressing GFP (“sgACO2-GFP”) 1:1 with cells expressing SLC13A2 cDNA and either sgAAVS1 or sgACO2 and passaged with vehicle or indicated concentrations of citrate for 21 days. Shown are the percent changes in green fluorescent protein (GFP)-negative cells cultured with citrate relative to vehicle at each time point. (K) Immunoblot of cells with control (sgAAVS1; –) or ACO2 editing (+) expressing EGFP (–) or SLC13A2 cDNA (+), cultured as indicated for 24 h. Data are n = 1 (J) or mean ± SD with n = 3 (F–I) independent replicates. Significance was assessed using two-way ANOVA with Sidak’s multiple-comparisons post-test as indicated (C), relative to control water (A), relative to vehicle (F–H), or relative to sgAAVS1 + SLC13A2 -expressing cells (I), using log-rank (Mantel-Cox) test (B), or using the fgsea package in R (D). See also .

Journal: Cell

Article Title: Citrate clearance is a major function of aconitase 2 in the canonical TCA cycle

doi: 10.1016/j.cell.2026.01.028

Figure Lengend Snippet: (A) Serum citrate concentration in mice provided drinking water supplemented with NaCl (control) or 3% citrate 10 days post tamoxifen administration (control water: n = 12 Aco2 +/+ , 11 Aco2 fl/fl ; citrate water: n = 14 Aco2 +/+ , 10 Aco2 fl/fl ). (B) Survival curves of indicated mice post tamoxifen (TAM) administration (control water: n = 4 Aco2 +/+ , 9 Aco2 fl/fl ; citrate water: n = 9 Aco2 +/+ , 12 Aco2 fl/fl ). (C) Violin plot depicting Z scores of 122 ISR-related genes in kidneys harvested from mice provided regular water or water supplemented with 3% citrate 10 days post tamoxifen administration ( n = 6 for all conditions except n = 7 for Aco2 fl/fl mice on 3% citrate). (D) Normalized enrichment scores of gene sets related to kidney injury or proximal tubule (PT) identity from RNA sequencing of kidneys described in (C), comparing Aco2 fl/fl vs. Aco2 +/+ animals on regular water (left column) or 3% citrate (right column). Selected gene sets represent genes increased or decreased following acute kidney injury (AKI), associated with AKI in PT cells specifically, or clusters associated with normal PT identity (segments 1–3) or injury. (E) SLC13A2 and SLC13A5 expression in cancer cell lines of kidney ( n = 51) or liver ( n = 27) lineage (TPM, transcripts per million). (F) Citrate levels in HepG2 cells cultured as indicated for 24 h. (G and H) Percent DAPI-positivity (G) or population doublings (H) in HepG2 cells cultured as indicated for 3 days. (I) Percent DAPI-positive cells of indicated genotype cultured in 5 mM (A549) or 1 mM (Calu1) citrate for 3 days. (J) Cellular competition experiment mixing ACO2 -edited cells expressing GFP (“sgACO2-GFP”) 1:1 with cells expressing SLC13A2 cDNA and either sgAAVS1 or sgACO2 and passaged with vehicle or indicated concentrations of citrate for 21 days. Shown are the percent changes in green fluorescent protein (GFP)-negative cells cultured with citrate relative to vehicle at each time point. (K) Immunoblot of cells with control (sgAAVS1; –) or ACO2 editing (+) expressing EGFP (–) or SLC13A2 cDNA (+), cultured as indicated for 24 h. Data are n = 1 (J) or mean ± SD with n = 3 (F–I) independent replicates. Significance was assessed using two-way ANOVA with Sidak’s multiple-comparisons post-test as indicated (C), relative to control water (A), relative to vehicle (F–H), or relative to sgAAVS1 + SLC13A2 -expressing cells (I), using log-rank (Mantel-Cox) test (B), or using the fgsea package in R (D). See also .

Article Snippet: The following sgRNA sequences were used: Chr8: 5’ GACATTTCTTTCCCCACTGG 3’ AAVS1: 5’ GGGGCCACTAGGGACAGGAT 3’ ACO2 ( homo sapiens ) guide 1: 5’ AGCGAGGCAAGTCGTACCTG 3’ ACO2 ( homo sapiens ) guide 2: 5’ CCAGCCAGGAAATTGAGCG 3’ PDK1 ( homo sapiens ) guide 1: 5’ GAACTGCTTCATGGAGAGCG 3’ PDK1 ( homo sapiens ) guide 2: 5’ TTGCCGCAGAAACATAAATG 3’ CS ( homo sapiens ) guide 1: 5’ CAACATGGCAAGACGGTGGT 3’ CS ( homo sapiens ) guide 2: 5’ AACTGGACATATCCCAACAG 3’ ACL ( homo sapiens ) guide 1: 5’ ACCAGCTGATCAAACGTCG 3’ ACL ( homo sapiens ) guide 2: 5’ AGAATCGGTTCAAGTATGCT 3’ ACO1 ( homo sapiens ) guide 1: 5’ CCATTGGATCCTGTACAACC 3’ ACO1 ( homo sapiens ) guide 2: 5’ TCCTGCAGGATGACACGAGC 3’ SLC25A1 ( homo sapiens ): 5’ CGTCTTCACGTACTCGGTG 3’ ACO2 ( mus musculus ) guide 1: 5’ GCCAACCAGGAGATCGAGCG 3’ ACO2 ( mus musculus ) guide 2: 5’ ACTGATTCGCACACCCCCAA 3’ To stably introduce expression of mitochondrially-targeted Lactobacillus brevis NADH oxidase, mito Lb NOX cDNA (Addgene, 74448) was cloned into pCDH-CMV-MCS-EF1α-puro (System Biosciences, CD510B-1).

Techniques: Concentration Assay, Control, RNA Sequencing, Expressing, Cell Culture, Western Blot